in-house method similar to the artic primers (Eurofins)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Eurofins in-house method similar to the artic primers
In House Method Similar To The Artic Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+method/in+house+method+similar+to+the+artic+primers/pm39705295-48-17-7
Average 90 stars, based on 1 article reviews

in-house method similar to the artic primers - by Bioz Stars, 2026-10

90/100 stars

Images

Microarray:

Article Title: Extensive SUMO Modification of Repressive Chromatin Factors Distinguishes Pluripotent from Somatic Cells
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Lipofectamine 2000 Thermo Scientific Cat# 301705 Q5 Site-Directed mutagenesis kit New England Biolabs Cat# E0554S Gateway BPTM ClonaseTM II Enzyme mix Thermo Scientific Cat# 11789020 Gateway LRTM Clonase IITM Enzyme mix Thermo Scientific Cat# 11791020 Sep-Pak C8 3 cc Vac Cartridge Waters Cat# WAT036780 Empore SPE Disks Sigma Aldrich Cat# 66883-U ReproSil-Pur 120 C18-AQ, 1.9 mm Dr. Maisch Cat# r119.aq. .. Deposited Data Micro-array dataset This study NCBI GEO: GSE144881 Raw MS data (SUMOylome) This study ProteomeXchange: PXD017697 Raw MS data (total proteome) This study ProteomeXchange: PXD020287 Experimental Models: Cell Lines R1 mouse ES cells Cossec et al., 2018 N/A MERVL::tdTomato Dppa4 KO ES cells Laboratory of W.Reik N/A MERVL::tdTomato Dppa2 KO ES cells Laboratory of W.Reik N/A MERVL::tdTomato Dppa2/4 double KO ES cells Laboratory of W.Reik N/A Mouse embryonic fibroblasts This study N/A Experimental Models: Organisms/Strains Mouse: C57BL/6J Institut Pasteur N/A Oligonucleotides and plasmids Mutagenesis primers Eurofins See Method Details for sequences pCMV6-entry Dppa2 WT plasmid Origene Cat# MR224204 pCMV6-entry Dppa2 K31R plasmid This study N/A MGC Mouse Dppa4 cDNA Horizon Cat# MMM1013-202805602 pCMV Dppa4 WT plasmid This study N/A pCMV K141R/K143R plasmid This study N/A pDONR221 plasmid Laboratory of Wolf Reik N/A pDEST eGFP plasmid Laboratory of Wolf Reik N/A pDEST Dppa2 WT-eGFP plasmid This study N/A pDEST Dppa2 K31R-eGFP plasmid This study N/A pDEST Dppa4 WT-eGFP plasmid This study N/A pDEST Dppa4 K141R/K143R-eGFP plasmid This study N/A siRNA Horizon Discovery Table S6 RT-qPCR primers Eurofins Table S6 Software and Algorithms STRING 11.0 Szklarczyk et al., 2019 N/A FlowJo software N/A https://www.flowjo.com/ Graphpad – Prism software N/A https://www.graphpad.com/ Cytoscape software Shannon et al., 2003 https://cytoscape.org/ MaxQuant version 1.5.3.30 Cox et al., 2011 https://www.maxquant.org/ Perseus Tyanova et al., 2016 https://maxquant.net/perseus/ Other MEF and ESC RNA-seq data Cossec et al., 2018 NCBI GEO: GSE99009 Cell Reports 32, 108146, September 15, 2020 e2 Resource ll OPEN ACCESS Resource ll OPEN ACCESS ..

Mutagenesis:

Article Title: An ancestral fold reveals the evolutionary link between RNA polymerase and ribosomal proteins
Article Snippet: The synthetic DNAs encoding the protein mutants used in this study, except for the design-3, -4, and -5 (Ph1_DG, Ph1_GG, and Ph1_GD), were purchased from Thermo Fisher Scientific and Integrated DNA Technologies and were amplified by PCR with the cloning_upstream and cloning_downstream primers (Eurofins Genomics; Supplementary Table ). .. The genes encoding the design-3, -4, and -5 were constructed by the Splicing by Overlap Extension method with the mutant primers (Eurofins Genomics; Supplementary Table ) . .. The linear pET47b DNA was also amplified with pET47b_up and pET47b_down primers (Eurofins Genomics; Supplementary Table ).

Article Title: Structures of DPAGT1 Explain Glycosylation Disease Mechanisms and Advance TB Antibiotic Design.
Article Snippet: .. The Megaprimer method uses a single oligonucleotide primer containing each desired mutation was synthesized (Eurofins Genomics). ..

Plasmid Preparation:

Quantitative RT-PCR:

Software:

RNA Sequencing:

other:

Article Title: Gastric bypass surgery weight loss-independently induces gut Il-22 release in association with improved glycemic control in obese Zucker fatty rats
Article Snippet: Primer sequences for Il-22 were TTCTCCTCCCAGTTATCAGTTGT for the forward primer and GGTGCGGTTGACGATGTAT for the reverse primer [ ]. mRNA expression of Il-22 was determined with the ΔΔ Ct method using Gapdh (forward primer: TGGATAGGGTGGCCGAAGTA and reverse primer: AAAGGCGGAGTTACAAGGGG; Eurofins) as the reference gene and expressed relative to the Sham group.

Polymerase Chain Reaction:

Article Title: The role of interleukin-1β in type 2 diabetes mellitus: A systematic review and meta-analysis
Article Snippet: 5 , ( ) India , T2DM: N= 80 Age= NM BMI=NM HC: N= 80 Age= NM BMI= NM , Serum/Cytometric Bead Array (CBA) method 558279 (IL-1β flex set) , * IL-1β levels were significantly increased in the T2DM group (P= 0.019) in early middle aged (31-40 years) and not effected in late middle aged (41-50 years) (P=0.167). * IL-1β did not show a significant association with ageing among the T2DM group. , * Oxidative stress and proinflammatory markers (including IL-1β) were significantly increased in the early-middle-aged (31-40 years) T2DM group compared to the HC group. * One-point single-centered study.. .. 6 , ( ) India , T2DM: N= 558 (293/265) Age= 57.29 ± 9.41 BMI= 26.18 ± 5.38 HC: N= 1085 (553/532) Age= 37.72 ± 17.19 BMI= 23.74 ± 6.04 , Whole blood/quantitative PCR using SYBR Green method and their respective forward and reverse primers (Eurofins, Bangalore, India) Real-time PCR (LightCycler480 Real- Time PCR, Roche) was performed in duplicate in 10 μl volume using LightCycler480 SYBR Green I Master mix (Roche Diagnostics GmbH, Mannheim, Germany) as per the instruction manual , * No difference in the genotype and allele frequencies (IL-1β -511C/T polymorphism) was observed between the T2DM and the HC group. * There was also no difference between genotype frequency TT vs TC while TT vs CC frequency differed significantly in the T2DM and the HC group. * mRNA levels of IL-1β were significantly higher in the T2DM group compared to the HC group. * 4-fold higher expression of IL-1β transcript in the T2DM group compared to the HC group. , * The study proposes the possible involvement of IL-1β polymorphisms for genetic susceptibility to T2DM in Gujarat population. * Limited to Gujarat population.. .. 7 , ( ) Korea , T2DM: N= 141(60/81) Age= 56.5 ± 10.7 BMI= 23.5 ± 3.5 HC: N= 22 (11/11) Age= 51.6 ± 6.0 BMI= 23.0 ± 2.6 , Plasma/DLB50, R&D systems , * IL-1β levels were significantly increased in patients with T2DM (P <0.001). * The circulating cell-free mitochondrial DNA (ccf-mtDNA) levels were increased in patients with type 2 diabetes. * Weak correlation between the elevated ccf-mtDNA levels and IL-1β levels in plasma from patients with type 2 diabetes. , * Provides evidence that elevated ccf-mtDNA levels may contribute to chronic inflammation in patients with type 2 diabetes. * Small sample size of HC group..

SYBR Green Assay:

Real-time Polymerase Chain Reaction:

Article Title: Integrated nucleic acid testing system to enable TB diagnosis in peripheral settings
Article Snippet: .. LAMP oligonucleotide primers were purchased from Integrated DNA Technologies (Coralville, IA) while the reference qPCR method primers were purchased from Eurofins Scientific (Louisville KY). .. As target for the isothermal amplification reactions, we used M.tb genomic DNA (H37Ra) commercially available from ATCC (Manassas, VA).

Expressing:

Construct:

Overlap Extension Polymerase Chain Reaction:

Synthesized:

Purification:

Article Title: A mycoparasitic and opportunistic fungus is inhabited by a mycovirus.
Article Snippet: A novel bisegmented double-stranded RNA virus was identified in the mycoparasitic and opportunistic fungus Hypomyces chrysospermus.. The RNA1 genome segment comprises 1866 bp and encodes an RNA-dependent RNA polymerase (RdRp).. The RNA2 segment comprises 1822 bp and encodes a capsid protein.

Review